ملف:Nussinov78 AF083069.1 1-43.svg

Secondary structure of a maximal basepairing of a RNA subsequence of the Echovirus 5 genome (EMBL Accession number AF083069.1_1-43). This structure is predicted with the Nussinov 78 algorithm und is one of 42 optimal structures. The input sequence is "UUAAAACAGCCUGUGGGUUGCACCCACCCACAGGGCCCACUGG" and the dot-bracket string of the shown secondary structure is "(())..(.()(((((((((())...)))))))((()))(.)))". The image was created and exported with RNAMovies 2.04 as svg. To correct the margin it was edited with Inkscape.