ملف:Nussinov78 AF083069.1 1-43.svg
![ملف:Nussinov78 AF083069.1 1-43.svg](/w/images/thumb/6/6f/Nussinov78_AF083069.1_1-43.svg/512px-Nussinov78_AF083069.1_1-43.svg.png?20231215195028)
حجم معاينة PNG لذلك الملف ذي الامتداد SVG: 512 × 512 بكسل. البعد الآخر: 2٬048 × 2٬048 بكسل.
الملف الأصلي (ملف SVG، أبعاده 512 × 512 بكسل، حجم الملف: 24 كيلوبايت)
وصف قصير
⧼wm-license-information-description⧽ |
Secondary structure of a maximal basepairing of a RNA subsequence of the Echovirus 5 genome (EMBL Accession number AF083069.1_1-43). This structure is predicted with the Nussinov 78 algorithm und is one of 42 optimal structures. The input sequence is "UUAAAACAGCCUGUGGGUUGCACCCACCCACAGGGCCCACUGG" and the dot-bracket string of the shown secondary structure is "(())..(.()(((((((((())...)))))))((()))(.)))". The image was created and exported with RNAMovies 2.04 as svg. To correct the margin it was edited with Inkscape. |
⧼wm-license-information-date⧽ | |
⧼wm-license-information-source⧽ | ⧼Wm-license-own-work⧽ |
⧼wm-license-information-author⧽ | Bgw |
ترخيص
|
تاريخ الملف
اضغط على زمن/تاريخ لرؤية الملف كما بدا في هذا الزمن.
زمن/تاريخ | صورة مصغرة | الأبعاد | مستخدم | تعليق | |
---|---|---|---|---|---|
حالي | ★ مراجعة معتمدة 19:50، 15 ديسمبر 2023 | ![]() | 512 × 512 (24 كيلوبايت) | Pastakhov (نقاش | مساهمات) | Upload https://upload.wikimedia.org/wikipedia/commons/6/6f/Nussinov78_AF083069.1_1-43.svg |
لا يمكنك استبدال هذا الملف.
وصلات
لا يوجد صفحات تصل لهذه الصورة.